|
-------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Current U.S. Class:
424/94.4; 424/94.2; 435/189; 514/6 -------------------------------------------------------------------------------- References Cited [Referenced By] -------------------------------------------------------------------------------- U.S. Patent Documents Other References Primary Examiner: Achutamurthy;
Ponnathapu -------------------------------------------------------------------------------- Parent Case Text --------------------------------------------------------------------------------
Claims --------------------------------------------------------------------------------
1. A method of reducing injury caused by superoxide radicals to an organ recipient following organ transplantation which comprises administering to the recipient an effective amount of a therapeutic composition comprising an enzymatically active CuZn superoxide dismutase having the amino acid sequence and enzymatic activity of natural human CuZn superoxide dismutase and a suitable carrier. 2. A method according to claim 1 wherein the organ is a kidney. 3. A method of reducing spinal cord injury caused by superoxide radicals in a subject due to reperfusion following spinal cord ischemia which comprises administering to the subject an effective amount of a therapeutic composition comprising an enzymatically active CuZn superoxide dismutase having the amino acid sequence and enzymatic activity of natural human CuZn superoxide dismutase and a suitable carrier. 4. A method of reducing
spinal cord injury caused by superoxide radicals in a subject which comprises
administering to the subject by infusion into the subject's blood, an
effective amount of a therapeutic composition comprising an enzymatically
active CuZn superoxide dismutase having the amino acid sequence and enzymatic
activity of natural human CuZn superoxide dismutase and a suitable carrier.
Description --------------------------------------------------------------------------------
One aspect of genetic engineering involves the insertion of foreign DNA sequences derived from eucaryotic sources into Escherichia coli or other microorganisms. A further refinement of genetic engineering concerns inducing the resulting microorganism to produce polypeptides encoded by the foreign DNA. Production of polypeptides can be considered a two-step process, with each step including numerous substeps. The two steps are transcription and translation. To produce a polypeptide efficiently and in quantity both steps of the process must be efficient. Transcription is the production of mRNA from the gene (DNA). Translation is the production of polypeptide from the mRNA. A critical substep of the transcription process is initiation, that is, the binding of RNA polymerase to a promoter-operator region. The sequence of deoxyribonucleotide bases which make up the promoter region may vary and thereby effect the relative efficiency of the promoter. The efficiency depends on the affinity of the RNA polymerase for the promoter. The efficiency of translation is affected by the stability of the mRNA. Increased stability of the mRNA permits improved translation. Although the exact determinants of mRNA stability are not precisely known, it is known that mRNA secondary structure as determined by the sequence of its bases has a role in stability. The initial substep of translation involves binding of the ribosome to a base sequence on the mRNA known as the Shine-Dalgarno sequence or the ribosomal binding site (RBS). The synthesis of polypeptides begins when the ribosome migrates along the mRNA to the AUG start codon for translation. Generally these codons are found approximately 10 bases "downstream" from the Shine-Dalgarno site. Factors which increase the efficiency of translation include those which enhance binding of the ribosomes to the Shine-Dalgarno site. It has been shown that the structure of the mRNA in the region of the Shine-Dalgarno sequence and the AUG codon and the distance between the Shine-Dalgarno sequence and the AUG codon each play a critical role in determining the efficiency of translation. Other factors which affect the efficiency of translation are premature termination and attenuation. Efficiency of translation can be improved by removing the attenuation sites. A difficulty encountered in attmpts to produce high amounts of eucaryotic polypeptides in bacterial cells nvolves the inability of cells producing large amounts of mRNA to grow efficiencly. This difficulty can be eliminated by preventing trranscription by a process known as repression. In repression genes are switched off due to the action of a protein inhibitor (repressor protein) which prevents transcription by binding to the operator region. After microorganisms have grown to desired cell densities, the repressed genes are activated by destruction of the repressor or by addition of molecules known as inducers which overcome the effect of the repressor. Numerous reports may be found in the literature concerning the cloning of eucaryotic genes in plasmids containing the P.sub.L promoter from .lambda. bacteriophase. (Bernard, H. V., et al., Gene (1979) 5, 59; Derom, C., et al., Gene (1982) 17, 45; Gheysen, D., et al., Gene (1982) 17, 55; Hedgpeth, J., et al., Mol. Gen. Genet. (1978) 163, 197; Remaut, E., et al., (1981) Gene 15, 81 and Derynck, R., et al., Nature (1980) 287, 193. In addition, European Patent Application No. 041,767, published Dec. 16, 1981, describes expression vectors containing the P.sub.L promoter from bacteriophage. However, none of these references describe the use of the C.sub.II ribosomal binding site. The use of a vector containing the P.sub.L promoter from .lambda. bacteriophage and the C.sub.II ribosomal binding site has been described. (Oppenheim, A. B., et al., J. Mol. Biol. (1982) 158, 327 and Shimatake, H. and Rosenberg, M., Nature (1981) 292, 128.) These publications describe the production of increased levels of C.sub.II protein but do not involve or describe the production of eucaryotic proteins. Other vectors which contain the P.sub.L promoter and the C.sub.II ribosomal binding site have also been described (Courntey, M., et al., PNAS (1984) 81:669-673; Lautenberger, J. A., et al., Gene (1983) 23:75-84 and Lautenberger, J. A., et al., Science (1983) 221:858-860). However, all of these vectors lead to the production of fused proteins which contain the amino terminal portion of the C.sub.II protein. In 1982 Shatzman and Rosenberg presented a poster at the 14th Miami Winter Symposium (Shatzman, A. R. and Rosenberg, M., 14 Miami Winter Symposium, abstract p98 [1982]). This abstract provides a non-enabling disclosure of the use of a vector containing P.sub.L from .lambda. bacteriophage, Nut and the C.sub.II ribosomal binding site to synthesize a "eucaryotic" polypeptide (SV40 small T antigen is actually not a eucaryotic polypeptide but a viral protein) in an amount greater than 5% of the cell protein in an unnamed bacterial host. The operator used is not defined. Neither an origin of replication nor a gene for a selectable phenotype is identified. This system with which the vector is used is described as including certain host lysogens into which the vector can be stably transformed. Applicants are aware of the existence of a pending U.S. patent application in the name of M. Rosenberg filed under Ser. No. 457,352 by the National Institutes of Health, Dept. of Health and Human Services, U.S.A. Portions of this application have been obtained from the National Technical Information Service, U.S. Dept. of Commerce. However, the claims are not available and are maintained in confidence. The available portions of the application have been reviewed. This disclosure is not enabling. It indicates that the host is important (p8, line 17) but fails to identify any suitable host. It further depends upon the use of a .lambda. mutant which is not specified (p4, line 20). It indicates that the host contains lysogens (p8, line 18) unlike the present invention in which the host is not lysogenic. It mentions cloning and expression of a eucaryotic gene, monkey metallothionein gene, (p7, line 18) but does not provide details. It specifies that neither the sequence nor the position of any nucleotide in the C.sub.II ribosomal binding region has been altered (p3, line 27). Pending, co-assigned U.S. patent application Ser. No. 514,188, filed Jul. 15, 1983, describes novel vectors useful for the expression of polypeptides in bacteria. These vectors include .lambda.P.sub.L O.sub.L, the N utilization site for binding antiterminator N protein, a ribosomal binding site, an ATG codon, a restriction enzyme site for inserting a gene encoding a desired polypeptide, an origin of replication and a selectable marker. In these vectors the distance between the N utilization site and the ribosomal binding site is greater than about 300 base pairs. In addition, each of these vectors contains a specific ribosomal binding site which cannot be readily replaced. These vectors are not equally useful for expression of different polypeptides. U.S. Ser. No. 514,188 also discloses a method of producing the polypeptide encoded in the vector by growing a host containing the vector, inducing polypeptide expression and recovering the polypeptide. Superoxide dismutase (SOD) and analogs thereof are some of several polypeptides which may be produced using the vector and methods disclosed in Ser. No. 514,188. The present invention relates to expression plasmids which unexpectedly provide enhanced expression of superoxide dismutase and analogs thereof. By employing different ribosomal binding sites in the plasmids of this invention it is possible to achieve enhanced expression levels of superoxide dismutase or analog thereof relative to the levels achieved with the previous vectors. In addition, using the same ribosomal binding sites as in the previous vectors, it is possible to achieve enhanced expression of superoxide dismutase or the analog. The present invention also relates to a method for enhanced production of SOD and analogs thereof in bacteria, including prototrophic and lytic bacteria, utilizing these plasmids. The present invention also provides for plasmids and methods which exclusively produce the non-acetylated analog of human CuZn superoxide dismutase having an amino acid sequence identical to that of natural human CuZn superoxide dismutase. Superoxide dismutase is of considerable interest because of its pharmacological properties. Bovine-derived, naturally-occurring superoxide dismutase (orgotein) has been recognized to possess anti-inflammatory properties and is currently marketed in certain European countries, e.g., West Germany, for use in the treatment of inflammation. It is also sold in a number of countries including the United States as a veterinary product for treating inflammation, particularly for treating inflamed tendons in horses. Additionally, the scientific literature suggests that SOD may be useful in a wide range of clinical applications. These include prevention of oncogenesis and tumor promotion and reduction of cytotoxic and cardiotoxic effects of anti-cancer drugs (Oberley, L. W. and Buettner, G. R., Cancer Research 39, 1141-1149 (1979)); protection of ischemic tissues (McCord, J. M. and Roy, R. S., Can. J. Physiol. Pharma. 60, 1346-1352 (1982)), and protection of spermatozoa (Alvarez, J. G. and Storey, B. T., Biol. Reprod. 28, 1129-1136 (1983)). In addition, there is a great interest in studying the effect of SOD on the aging process (Talmasoff, J. M., Ono, T. and Cutler, R. G., Proc. Natl. Acad. Sci. USA 77, 2777-2782 (1980)). The present invention also relates to using human superoxide dismutase analogs to catalyze the reduction of superoxide radicals in the presence of H.sup.+, to hydrogen peroxide and molecular oxygen. In particular, the present invention concerns using hSOD analogs to reduce reperfusion injury following ischemia and prolong the survival period of excised isolated organs. It also concerns the use of hSOD or analogs thereof to reduce injury on reperfusion following organ transplantation and spinal cord ischemia. These analogs may also be used for bronchial pulmonary dysplasia. The human CuZn superoxide dismutase and analogs thereof of the present invention are commercially advantageous in that they are less toxic than orgotein and have enhanced stability to lyophilization while retaining their enzymatic activity. SUMMARY OF THE INVENTION A plasmid for the production of superoxide dismutase or analog thereof which upon introduction into a suitable bacterial host cell containing the thermolabile repressor C.sub.I renders the host cell capable, upon increasing the temperature of the host cell to a temperature at which the repressor is inactivated of effecting expression of DNA encoding superoxide dismutase or the analog and production of superoxide dismutase or the analog comprising: a double-stranded DNA molecule which includes in 5' to 3' order the following: a DNA sequence which contains the promoter and operator P.sub.L O.sub.L from lambda bacteriophage; the N utilization site for binding antiterminator N protein produced by the host cell; a first restriction enzyme site permitting replacement of the DNA sequence containing the ribosomal binding site which follows thereafter; a DNA sequence which contains a ribosomal binding site for rendering the mRNA of the gene encoding superoxide dismutase or analog thereof capable of binding to ribosomes within the host cell; an ATG initiation codon; a second restriction enzyme site; a gene encoding superoxide dismutase or the analog thereof in phase with the ATG initiation codon; and which additionally includes a DNA sequence which contains an origin of replication from a bacterial plasmid capable of autonomous replication capable of autonomous replication in the host cell and a DNA sequence which contains a gene associated with a selectable or identifiable phenotypic trait which is manifested when the plasmid is present in the host cell, the distance between the 3' end of the P.sub.L O.sub.L promoter and operator sequence and the 5' end of the N utilization site being less than about 80 base pairs and the distance between the 3' end of the N utilization site and the 5' end of the ribosomal binding site being less than about 300 base pairs. The plasmids of the invention can be introduced into suitable hosts where the gene for superoxide dismutase or SOD analog can be expressed and the superoxide dismutase or analogs thereof produced. The presently preferred plasmids for human superoxide dismutase are: pSOD.beta..sub.1 T.sub.11, pSOD.beta.MAX.sub.10 and pSOD.beta.MAX.sub.12. Preferred hosts include Escherichia coli, in particular, autotrophic E. coli A1645; prototrophic E. coli A4200 and A4255, and lytic E. coli A4048. A1637 was obtained from C600 by inserting transposon containing tetracycline resistance gene within the galactose operon as well as the lambda system for expression which is close to galactose operon. C600 is available from the American Type Culture Collection, as ATCC Accession No. 23724. A1645 was obtained from A1637 by selection for Gal.sup.+ (ability to ferment galactose) as well as loss of tetracycline resistance. It still contains the lambda expression system but part of the transposon has been removed by selection. Its phenotype is C600 r.sup.- m.sup.+ gal.sup.+ thr.sup.- leu.sup.- lacZ.sup.- bl (.lambda.c1857 .DELTA.Hl .DELTA.BamHl N.sup.+). A1645 is presently a more preferred strain for expression of genes encoding superoxide dismutase or analogs thereof. It has been deposited with the American Type Culture Collection in Rockville, Md., U.S.A. containing various plasmids as described more fully hereinafter. All deposits were made pursuant to the Budapest Treaty on the International Recognition of the Deposit of Microorganisms except that pBR322 and pBRM are fully available from the American Type Culture Collection as ATCC Accession Nos. 37017 and 37283, respectively, the D4 was deposited under ATCC Accession No. 31826 in connection with the filing of a U.S. patent application. Prototrophic strains of Escherichia coli which enable high level polypeptide expression even when grown in a minimal media may also be used as hosts for the vectors of this invention. Preferred prototrophic strains include A4200 and A4255. Strain A4255 containing the plasmid p9200 has been deposited with the ATCC under Accession No. 53215. Even more preferred are biotin independent prototrophic strains such as A4346 containing the plasmid pGH44 which has been deposited with the ATCC under Accession No. 53218. Lytic strains of Escherichia coli may also be used as hosts for the vectors of this invention. Suitable lytic strains include those which produce, at the temperature at which the polypeptide is produced but at a rate slower than that at which the polypeptide is produced, a substance e.g., an enzyme like endolysin which will cause the cell to lyse. This permits the cell to produce relatively large amounts of the desired polypeptide before the amount of the lysing substance produced reaches the level which causes cell lysis. Examples of suitable lytic strains include those containing PlcI.sup.ts plasmid such as strain A4048 containing pGH44 which has been deposited with the ATCC under Accession No. 53217. The resulting host vector systems can be employed to manufacture superoxide dismutase or superoxide dismutase analogs. Host cells containing the plasmids are grown under suitable conditions permitting production of superoxide dismutase or the analog and the resulting superoxide dismutase or analog is recovered. Using the host vector systems, analogs of human superoxide dismutase have been prepared. Veterinary and pharmaceutical compositions containing these SOD analogs and suitable carriers have also been prepared. These superoxide dismutase analogs have been used to catalyze the following reaction: 2O.sub.2.sup.- +2H.sup.+ .fwdarw.H.sub.2 O.sub.2 +O.sub.2 More particularly, these analogs have been used to reduce injury caused by reperfusion following ischemia or organ transplantation, reduce cardiac infarct size, increase the survival time of excised isolated organs, and reduce spinal cord injury. DESCRIPTION OF THE FIGURES The restriction maps for each of the plasmids shown in FIGS. 1-31 do not identify all restriction sites present on each plasmid. In some cases restriction sites are shown in one figure but not in another. However, in all cases those restriction sites necessary for a complete understanding of the invention are shown. FIG. 1. Construction of pAL500. A plasmid containing bGH cDNA, D4 (ATCC No. 31826), was digested with HaeII. The resulting 1600 base pair large fragment was purified and digested at 37.degree. C. for 5 minutes with S1 exonuclease. A synthetic EcoRI linker with the sequence: GGAATTCC CCTTAAGG was attached to the ends of the resulting fragments by ligation. The ligation mixture was cleaved with EcoRI and inserted into pBR322 (ATCC No. 37017) which had been cleaved with EcoRI. A clone, pALRI, was obtained which upon cleavage with EcoRI released a 1200 base pair fragment with the sequence:
at the 5' end. This sequence demonstrates that pALRI contains an EcoRI restriction site which includes the TTC codon for residue number 1 (phenylalanine) of natural bGH. pALRI was subjected to a partial cleavage with PstI. The digest was treated with DNA polymerase I large fragment (Klenow) and HindIII lingers with the sequence: GAAGCTTC CTTCGAAG were attached by ligation. The ligation mixture was cleaved with EcoRI and HindIII. The fragment containing bGH cDNA was isolated and subcloned into pBR322 between the EcoRI and HindIII restriction sites to give pAL500 (ATCC No. 39782). FIG. 2. Construction of pRO211 and pRO12. The plasmid pJH200 (ATCC No. 39783) was partially digested with NdeI, treated with DNA polymerase I (Klenow) to fill in the ends and the resulting ends were religated to form the expression vector pRO211. The expression vector pRO211 was digested with NdeI and HindIII, the large fragment isolated and ligated to an NdeI-HindIII bGH fragment isolated from pAL500 (ATCC No. 39782) to give pRO12. (The NdeI-HindIII fragment was produced from pAL500 by digesting it with EcoRI and ligating to the ends of the digestion product synthetic linkers with the sequence:
The ligation mixture was digested with NdeI and HindIII and the resulting NdeI-HindIII bGH fragment isolated.) FIG. 3. Construction of pSAL 5200-6 pRO12 (FIG. 2) was partially digested with PvuII followed by digestion with NdeI to eliminate a 72 base pair fragment. A synthetic DNA fragment coding for the first 24 amino acids of the N-terminus of authentic bGH was ligated to the digested pRO12. The synthetic DNA fragment was constructed by annealing two phosphorylated synthetic single-stranded DNAs of the sequence:
The annealed fragment was treated with DNA polymerase I (Klenow) in the presence of all four deoxyribonucleoside triphosphates in order to form the full length double-stranded DNA. The fragment was digested with PvuII and NdeI before ligation to pRO12 to form pSAL 5200-6. FIG. 4. Construction of p3008. p3008 (ATCC No.39804) was constructed by ligating NdeI-digested pRO211 (FIG. 2) with the pGH fragment isolated from an NdeI digest of the plasmid ppGH-NdeI/RI. ppGH-NdeI/RI contains full length pGH cDNA to both ends of which NdeI sites have been added by means of synthetic linkers. FIG. 5. Construction of p5002. p5002 was constructed by tripartite ligation of a dimerized synthetic linker and the 2 cGH fragments isolated from an NdeI and BanII digest of the plasmid pcGH-NdeI/RI. The ligation mixture was digested with NdeI and then ligated to the expression vector pRO21L (FIG. 2) after it had be restricted with NdeI. A colony containing the plasmid p5002 was isolated. The synthetic linker was constructed from two single-stranded synthetic DNAs of the sequence:
The linker was phosphorylated before ligation. The linker codes for the first 18 amino acids of the N-terminus of the authentic cGH. The plasmid pcGH-NdeI/RI contains full length cGH cDNA at the 5' end of which there is an EcoRI restriction site and at the 3' end of which there is an NdeI restriction site. These restriction sites were added by means of synthetic linkers. FIG. 6. Construction of pHG44 and pHG50. pRO12 (FIG. 2) was digested with HindIII. The linear form DNA (form III) was purified from agarose gel and ligated to a HindIII-HindIII fragment of about 1200 base pairs which contains the rRNA operon transcription termination sequences T.sub.1 T.sub.2. The T.sub.1 T.sub.2 HindIII-HindIII fragment was isolated from plasmid pPS1 (ATCC No. 39807) which had been digested with HindIII. The resulting plasmid pHG44 (ATCC No. 39806) contains the T.sub.1 T.sub.2 sequences at the 3' end of the recombinant (rec) bGH sequence. The plasmid pSK434 (ATCC No. 39784) containing the .lambda.cI.sup.434 repressor sequences was digested with HpaII. The .lambda.cI.sup.434 HpaII-HpaII fragment was isolated and ligated to pHG44 which had been digested with ClaI. The resulting plasmid pHG50 (ATCC No. 39805) contains the T.sub.1 T.sub.2 transcription termination sequences and the .lambda.cI.sup.434 repressor sequence. FIG. 7. Construction of p8300-10A. The plasmid p8300-10A (ATCC No. 39785) which expresses an analog of the natural phenylalanine form of bGH having methionine at the N-terminus (met-phe bGH) was prepared as follows. The plasmid p7200-22 contains the .lambda.P.sub.L promoter and ribosomal binding site derived from pJH200 (ATCC No. 39783), DNA encoding met-phe bGH and the T.sub.1 T.sub.2 rRNA termination sequences. The ClaI-ClaI fragment containing the .lambda.P.sub.L promoter, the C.sub.II ribosomal binding site, the met-phe bGH gene and the T.sub.1 T.sub.2 transcription termination sequences was inserted into the unique ClaI site of plasmid pOP1.DELTA.6, a constitutive high copy number plasmid, to form p8300-10A. FIG. 8. Construction of pSAL-130/5 and pSAL-170/10. The plasmid pHG44 (ATCC No. 39806) expressing met-asp-gln bGH protein was digested with NdeI and HindIII. The resulting NdeI-HindIII bGH fragment was isolated and ligated to a fragment from p8300-10A (ATCC No. 39785) prepared by partial digestion with both NdeI and HindIII. Such a ligation replaces the met-phe bGH gene fragment with the met-asp-gln bGH gene fragment. The plasmid so obtained, pSAL-130/5, expresses rec bGH. pSAL-170/10 was obtained by treating the EcoRI-AvaI fragment containing the Tet.sup.R gene of pBR322 plasmid (ATCC No. 37017) with DNA polymerase I (Klenow) and inserting it into pSAL-130/5 which had been digested with BamHI and filled in with DNA polymerase I (Klenow). FIG. 9. Construction of pSAL-210/4. Linear form DNA (form III) was prepared by partial ClaI digestion of pSAL-170/10. It was purified from an agarose gel and ligated to a HpaII-HpaII cI.sup.434 gene fragment which was isolated from a HpaII digest of the plasmid pSK434 (ATCC No. 39784). FIG. 10. Construction of pSAL 5600-1. pSAL 5200-6 (FIG. 3) was digested with HindIII. The linear form DNA (form III) was purified from an agarose gel and ligated to a HindIII-HindIII fragment of about 1200 base pairs which contains the rRNA operon transcription termination sequences, T.sub.1 T.sub.2. The T.sub.1 T.sub.2 HindIII-HindIII fragment was isolated from the plasmid pPS1 (ATCC No. 39807) which was digested with HindIII. The resulting plasmid pSAL 5600-1 contains the T.sub.1 T.sub.2 sequences at the 3' end of the met-asp-gln bGH sequence. FIG. 11. Construction of D3009. The NdeI-NdeI pGH fragment was isolated from plasmid p3008 (ATCC No. 39804) (FIG. 5). The fragment was inserted into the unique NdeI site of the expression vector p579 (FIG. 19) which had been digested with NdeI. The resulting plasmid p3009 expresses an analog of natural porcine growth hormone protein having a methionine residue added at the N-terminus. FIG. 12. Construction of p5003. The NdeI-NdeI cGH fragment was isolated from plasmid p5002 The fragment was inserted into the unique NdeI site of the expression vector p579 (FIG. 19) which had been digested with NdeI. The resulting plasmid p5003 (ATCC No. 39792) expresses an analog of natural chicken growth hormone protein having a methionine residue added at the N-terminus. FIG. 13. Construction of pSOD.alpha.2. The pJH200 (ATCC No. 39783) expression vector was digested with NdeI. The 550 base pair NdeI fragment containing the .lambda.P.sub.L promoter and C.sub.II ribosomal binding site was isolated and inserted into the unique NdeI site of plasmid pSOD NH-10 which had been digested with NdeI. (Plasmid pSOD NH-10 is derived from a cDNA clone of human SOD [Lieman-Hurwitz, J., et al., PNAS (1982) 79:2808]) The resulting plasmid pSOD NH-550 was digested with AluI. (Only the relevant AluI site is shown in the figure.) The large AluI fragment containing the .lambda.P.sub.L promoter and the SOD gene was isolated. BamHI linkers were attached and the resulting fragment was digested with BamHI. The BamHI digestion product was inserted into the unique BamHI site of pBRM (ATCC No. 37283) to form pSOD.alpha.2 (ATCC No. 39786). FIG. 14. Construction of pSOD.alpha.13 and pSOD.beta.1. The plasmid pSOD.alpha.1 (ATCC No. 39786) was partially digested with EcoRI and the resulting linear form DNA was isolated from an agarose gel. The purified DNA was filled in with DNA polymerase I (Klenow) and religated. The resulting clone pSOD.alpha.13 contains one EcoRI site located at the 5' end of the ribosomal binding site. A fragment containing the .beta.-lactamase promoter and ribosomal binding site was isolated from plasmid pBLA11 (ATCC No. 39788) which had been digested with EcoRI and AluI. The 200 base pair fragment was ligated to the large fragment isolated from pSOD.alpha.13 which had been digested with NdeI, filled in with DNA polymerase I (Klenow) and then digested with EcoRI. The resulting plasmid pSOD.beta.1 contains the ribosomal binding site of the .beta.-lactamase gene and the .lambda.P.sub.L promoter. FIG. 15. Construction of pSOD.beta..sub.1 T.sub.11. Plasmid pBR322 (ATCC No. 37017) was digested with EcoRI and AvaI. The resulting DNA was filled in with DNA polymerase I (Klenow). The Tet.sup.R gene fragment was then isolated and ligated to the large fragment isolated from pSOD.beta.1 (FIG. 14) plasmid which had been digested with PstI followed by a partial BamHI digest and then filled in with DNA polymerase I (Klenow). The resulting plasmid pSOD.beta..sub.1 T.sub.11 (ATCC Accession No. 53468) contains the Tet.sup.R gene. FIG. 16. Construction of pSOD8.sub.1 TT-1. The rRNA T.sub.1 T.sub.2 transcription termination fragment was isolated from plasmid pPS1 (ATCC No. 39807) which had been digested with HindIII and filled in with DNA polymerase I (Klenow). The fragment was ligated to plasmid pSOD.beta..sub.1 T.sub.11 (FIG. 15) which had been partially digested with BamHI and filled in with DNA polymerase I (Klenow). FIG. 17. Construction of pSOD.beta..sub.1 -BA2. A synthetic DNA fragment with the sequence:
which is similar to the sequence of the natural .beta.-lactamase ribosomal binding site, was phosphorylated and ligated to the large fragment of pSOD.alpha.13 plasmid (FIG. 14) which had been digested with NdeI and EcoRI. FIG. 18. Construction of pTV-188. Plasmid pApoE-EX2 (ATCC No. 39787) was digested with NdeI and then fragments filled in with DNA polymerase r (Klenow). The resulting ApoE gene fragment was isolated and inserted into the unique blunt end StuI site of the pSOD.beta..sub.1 T.sub.11 plasmid (FIG. 15). The resulting plasmid pTV-188 expresses an ApoE fused protein. FIG. 19. Construction of p579. The rRNA operon T.sub.1 T.sub.2 transcription termination fragment was isolated from plasmid pPS1 (ATCC No. 39807) which had been digested with HindIII. The T.sub.1 T.sub.2 fragment was inserted into the unique HindIII site of pRO211 (FIG. 2) which had been digested with HindIII. The resulting expression vector, p579, contains the .lambda.P.sub.L promoter, the C.sub.II ribosomal binding site, followed by the T.sub.1 T.sub.2 transcription termination signals. FIG. 20. Construction of pTV-170. The NdeI-NdeI ApoE fragment was isolated from plasmid pApoE-EX2 (ATCC No. 39787) and inserted into the unique NdeI site of the expression vector p579 (FIG. 19) which had been digested with NdeI. The resulting plasmid pTV-170 expresses an analog of natural human ApoE protein having a methionine residue added at the N-terminus. FIG. 21. Construction of pTV-190. The plasmid pTV-170 (FIG. 20) was partially digested with NdeI and filled in with DNA polymerase I (Klenow). The isolated linear form DNA was religated to yield the plasmid pTV-190 which was analyzed and found to have only one NdeI site at the 5' end of the ApoE gene. FIG. 22. Construction of pTV-194. The .beta.-lactamase promoter and ribosomal binding site fragment was isolated from plasmid pBLA11 (ATCC No. 39788) after digestion with EcoRI and AluI. This fragment was ligated to the large fragment of pTV-170 (FIG. 20) plasmid which had been digested with NdeI, filled in with DNA polymerase I (Klenow) and then digested with EcoRI. FIG. 23. Construction of pSAL 160-5. An AvaI-AvaI fragment containing the ApoE DNA sequence was isolated from pTV-170 (FIG. 21) which was digested with AvaI. The fragment was filled in with DNA polymerase I (Klenow) and isolated on agarose gel. The purified ApoE fragment was inserted into the PstI site of the pTV 104(2) plasmid (ATCC No. 39334) which was partially digested with PstI and filled in with DNA Polymerase I (Klenow). The resulting plasmid is designated pSAL 160-5. FIG. 24. Construction of pTV-214. A synthetic fragment containing the first 14 amino acids of human growth hormone with the sequence:
was phosphorylated using .sup..gamma.-32 p-ATP and polynucleotide kinase. The phosphorylated linker was inserted into the unique NdeI site of pTV-190 plasmid which had been digested with NdeI. FIG. 25. DNA Sequence of the cloned hCuZnSOD in pSOD.beta..sub.1 T.sub.11 FIG. 25 shows the presence and location of two ATG codons located at the 5' end of the cloned human CuZn SOD gene in pSOD.beta..sub.1 T.sub.11 (ATCC Accession No. 53468) which was constructed as shown in FIG. 15. FIG. 26. Construction of p.DELTA.RB Plasmid Tet.sup.R expression vector, p.DELTA.RB, was generated from pSOD.beta..sub.1 T.sub.11 (ATCC Accession No. 53468) by complete digestion with EcoRI followed by partial cleavage with BamHI restriction enzymes. The digested plasmid was ligated with synthetic oligomer
resulting in p.DELTA.RB containing the .lambda.P.sub.L promoter. p.DELTA.RB contains unique restriction sites for insertion of ribosomal binding sites and genes downstream of the P.sub.L promoter. FIG. 27. Construction of p.beta.UN Construction of p.beta.UN, a general purpose expression vector, containing the .lambda.P.sub.L promoter and .beta.-lactamase promoter and RBS is shown in FIG. 27. Unique NdeI site followed by SmaI, XbaI and BglII sites were introduced downstream of the B-lactamase RBS for insertion of any desired gene. It should be pointed out that 3 nucleotide changes were made at the 3' end of the .beta.-lactamase RBS-, one to eliminate the first possible ATG (C instead of G) and two other changes to form the NdeI site (CA instead of AG). FIG. 28. Construction of pSOD.beta.MA The entire coding region of human CuZn SOD on a NdeI-BamHI fragment isolated from pSOD.alpha.13, was inserted between the unique NdeI and BglII sites of p.beta.UN as depicted in FIG. 28. The resulting vector, pSOD.beta.MA, is an intermediate plasmid used in the construction of the expression plasmids pSOD-.beta.MAX.sub.12 and pSOD-.beta.MAX.sub.10. FIG. 29 Construction of pSOD-.beta.MAX.sub.12 The plasmid pSOD-.beta.MAX.sub.12 was constructed from pSOD-.beta.MA by replacement of part of the ribosomal binding site with synthetic DNA. This causes a single base change in the sequence of the ribosomal binding site. The plasmid directs exclusive high level expression of a non-acetylated SOD analog which has an amino acid sequence identical to that of natural SOD. The analog is also non-glycosylated. pSOD.beta.MAX.sub.12 has been deposited with the American Type Culture Collection and assigned ATCC Accession No. 67177. FIG. 30 Construction of pSOD-.beta.MAX.sub.10 The plasmid pSOD-.beta.MAX.sub.10 was constructed from pSOD-.beta.MA by replacement of part of the ribosomal binding site with synthetic DNA. This causes a single base change in the sequence of the ribosomal binding site. The plasmid directs exclusive high level expression of a non-acetylated SOD analog which has an amino acid sequence identical to that of natural SOD. The analog is also non-glycosylated. FIG. 31 Modification of hSOD cDNA at 5' End and Construction of pSODNH-10 Plasmid pS61-10 was digested with PstI and the small PstI-PstI 620 bp fragment containing hSOD DNA was isolated. The purified fragment was separated into two equal aliquots. The first aliquot was treated with DNA polymerase (Klenow fragment) in order to obtain a blunt-ended fragment. The DNA fragment was ligated to HindIII phosphorylated linkers having the sequence: CAAGCTTG GTTCGAAC and treated with HindIII. The fragment was then ligated to pBR322 DNA which had been digested with HindIII and treated with bacterial alkaline phosphatase. The DNA ligation mixture was used to transform E. coli strain 1061 and Amp.sup.R clones were selected. These clones were screened by in situ filter hybridization to a nicked translated radioactive probe containing the hSOD DNA sequences. One of the positive clones, pSODH3, was analyzed by restriction mapping. The second aliquot of the 620 bp PstI-PstI fragment was digested with FokI and the 229 bp FokI-FokI fragment was isolated and ligated to a synthetic phosphorylated DNA linker having the sequence:
The DNA was then digested with NdeI and StuI. The newly formed 127 bp fragment with the synthetic linkers was ligated with T4 DNA ligase to the large DNA fragment of plasmid pSODH3 which was obtained by digestion with NdeI, StuI and SalI. The NdeI-NdeI fragment of about 2560 bp was isolated. The DNA ligation mixture was used to transform E. coli strain 1061 and Amp.sup.R transformants were selected. The clones were screened for the right plasmid construction by NdeI and HindIII double digestion. One of these clones (pSOD NH-10) was sequenced and used for the expression of the human CuZn hSOD. DETAILED DESCRIPTION OF THE INVENTION A plasmid has been developed which enables the achievement of enhanced levels of gene expression and polypeptide roduction. The plasmid is a double-stranded DNA molecule. Upon introduction into a suitable bacterial host cell containing the thermolabile repressor C.sub.I the plasmid renders the host cell capable, upon increasing the temperature of the host cell to a temperature at which the repressor is inactivated, of effecting expression of a desired gene inserted into the plasmid and production of a polypeptide encoded by the gene. The plasmid includes in 5' to 3' order the following: a DNA sequence which contains the promoter and operator P.sub.L O.sub.L from lambda bacteriophage; the N utilization site for binding antiterminator N protein; a first restriction enzyme site permitting replacement of the DNA sequence containing the ribosomal binding site which follows thereafter; a DNA sequence which contains a ribosomal binding site for rendering the mRNA of the desired gene capable of binding to ribosomes within the host cell; an ATG initiation codon or a DNA sequence which is converted into an ATG initiation codon upon insertion of the desired gene into the vector; a second restriction enzyme site for inserting the desired gene into the plasmid in phase with the ATG initiation codon; and a gene encoding the desired polypeptide. The plasmid also includes a DNA sequence which contains an origin of replication from a bacterial plasmid capable of automomous replication in the host cell-and a DNA sequence which contains a gene associated with a selectable or identifiable phenotypic trait which is manifested when the plasmid is present in the host cell. The distance between the 3' end of the P.sub.L O.sub.L promoter and operator sequence and the 5' end of the N utilization site is less than about 80 base pairs and the distance between the 3' end of the N utilization site and the 5' end of the ribosomal binding site is less, than about 300 base pairs. Another component of the plasmid is a first restriction enzyme site permitting replacement of the DNA sequence containing the ribosomal binding site which follows thereafter. Numerous such sites may be used. Suitable sites include EcoRI. Yet another component of the plasmid is a second restriction enzyme site for insertion of the desired gene into the plasmid in phase with the ATG initiation codon. Numerous such sites may be used. Suitable sites include NdeI, ClaI, HindIII, SmaI, BglII, XbaI, SacI and AluI. Generally it is desirable that the second restriction enzyme site also functions as the second restriction site necessary to permit replacement of the DNA sequence containing the ribosomal binding site. If the second restriction site is not also used for this purpose then the vector of this invention must also include a third restriction enzyme site after the ribosomal binding site but prior to the second restriction site. Preferably, the plasmid contains two unique restriction enzyme sites. The first site permits replacement of the DNA sequence containing the ribosomal binding site. The second site permits insertion of the desired gene into the plasmid in phase with the ATG initiation codon. The term "unique restriction enzyme" site as employed herein means a restriction enzyme site which occurs only once in the plasmid. In a presently preferred embodiment, EcoRI is the first restriction enzyme site and NdeI is the second restriction enzyme site. The preferred host for use with the plasmid is Escherichia coli. The presently preferred strains are A1637, A1645, A2602, A2097 and A1563. A1637 was obtained from C600 by inserting transposon containing tetracycline resistance gene within the galactose operon as well as the lambda system for expression which is close to galactose operon. c600 is available from the American Type Culture Collection, as ATCC Accession No. 23724. A1645 was obtained from A1637 by selection for Gal.sup.+ (ability to ferment galactose). as well as loss of tetracycline resistance. It still contains the lambda expression system but part of the transposon has been removed by selection. Its phenotype is C600 r.sup.- m.sup.+ gal.sup.+ thr.sup.- leu.sup.- lacZ.sup.- bl (.lambda.cI857 .DELTA.BamHI N.sup.+). A1645 is presently a more preferred strain for expression of superoxide dismutase or an analog thereof. It has been deposited with the American Type Culture Collection in Rockville, Md., U.S.A. containing various plasmids as described more fully hereinafter. All deposits were made pursuant to the Budapest Treaty on the International Recognition of the Deposit of Microorganisms except that pBR322 and pBRM are fully available from the American Type Culture Collection as ATCC Accession Nos. 37017 and 37283, respectively, and D4 was deposited under ATCC Accession No. 31826 in connection with the filing of a U.S. patent application. A2602 and A1563 are derived from SA500. Their phenotypes are SA500 his.sup.- ile.sup.- gal.sup.+ .DELTA.8 (.lambda.cI857 .DELTA.Hl .DELTA.Bam N.sup.+) and SA500 his.sup.- ile.sup.- gal.sup.+ .DELTA.8 lacZ.sup.- A21 .alpha. cI857 int2 xis1 nutL.sub.3 .DELTA.Hl), respectively. A2097 is derived from A1645. Its phenotype is A1645 lac.DELTA.X A21 proC::Tn10. Prototrophic strains of Escherichia coli which enable high level polypeptide expression even when grown in a minimal media may also be used as hosts for the vectors of this invention. Preferred prototrophic strains include A4200 and A4255. Strain A4255 containing the plasmid p9200 has been deposited with the ATCC under Accession No. 53215. Even more preferred are biotin independent prototrophic strains such as A4346 containing the plasmid pGH44 which has been deposited with the ATCC under Accession No. 53218. Lytic strains of Escherichia coli may also be used as hosts for the vectors of this invention. Suitable lytic strains include those which produce, at the temperature at which the polypeptide is produced but at a rate slower than that at which the polypeptide is produced, a substance e.g., an enzyme like endolysin which will cause the cell to lyse. This permits the cell to produce relatively large amounts of the desired polypeptide before the amount of the lysing substance produced reaches the level which causes cell lysis. Examples of suitable lytic strains include those containing the PlcI.sup.ts plasmid such as strain A4048 containing pGH44 which has been deposited with the ATCC under Accession No. 53217. Preferably, the plasmid is a covalently closed circular double-stranded molecule. However, it is not essential that the plasmid be covalently closed. The plasmid achieves its enhanced expression levels after the host cell is heated to a temperature at which the C.sub.I repressor protein is destroyed. A temperature above about 38.degree. C. is effective for this purpose and since it is desired that unnecessary heat damage to the host cells be avoided to as great an extent as possible, it is generally desirable that the temperature not exceed 42.degree. C. by more than a few degrees. One important component of the vector is the ribosomal binding site. Suitable sites are C.sub.II from lambda bacteriophage having the sequence: TAAGGAAATACTTACAT ATTCCTTTATGAATGTA; a mutant of C.sub.II from lambda bacteriophage having the sequence: TAAGGAAGTACTTACAT ATTCCTTCATGAATGTA; the major head protein gene of bacteriophage lambda having the sequence: TTTTTTTACGGGATTTTTTTATG AAAAAAATGCCCTAAAAAAATAC; the natural .beta.-lactamase ribosomal binding site derived from pBR322; a synthetic oligonucleotide having the sequence:
a synthetic oligonucleotide having the sequence:
a natural ribosomal binding site derived from Bacillus thurengensis. The plasmid also includes an origin of replication from a bacterial plasmid capable of autonomous replication in the host cell. Suitable such origins of replication may be obtained from a number of sources, e.g., from pBR322 or pR1. A DNA sequence which contains a gene associated with a selectable or identifiable phenotypic trait which is manifested when the plasmid is present in the host cell is also a component of the plasmid. Suitable genes include those associated with temperature sensitivity or drug resistance, e.g., resistance to ampicillin, chloroamphenicol or tetracycline. Relative to plasmids described previously, the plasmids of this invention may be used to obtain enhanced expression of a wide variety of genes encoding desirable polypeptide products. Suitable genes include those encoding growth hormones, e.g., bovine, porcine, chicken or human growth hormones; superoxide dismutase; apolipoprotein E or analogs of any of the preceding. By analog is meant a polypeptide having the same activity as the naturally occurring polypeptide but having one or more different amino acids added or deleted, or both, at the N-terminus of the polypeptide. The plasmid may be formed by methods well known to those of ordinary skill in the art to which the invention relates. Such methods are described in greater detail in various publications identified herein, the contents of which are hereby incorporated by reference into the present disclosure in order to provide complete information concerning the state of the art. One presently preferred plasmid is pJH200 which has the restriction map shown in FIG. 2. This plasmid was introduced into Escherichia coli using a strain A1645 conventional transformation method. The resulting host vector system has been deposited under ATCC Accession No. 39783. A gene encoding a desired polypeptide, e.g. bovine growth hormone, may be inserted into pJH200. A second preferred plasmid, pRO211, was constructed from a partial NdeI digest of pJH200. pRO211 has the restriction map shown in FIG. 2. Bovine growth hormone cDNA has been inserted into pRO211 by digesting the vector with NdeI and HindIII, isolating the large fragment and ligating to it bGH cDNA obtained from pAL500 (ATCC Accession No. 39782). The resulting plasmid is designated pR012. Its restriction map is also shown in FIG. 2. Plasmid pR012 has been partially digested with PvuII followed by NdeI. A synthetic DNA fragment coding for the first 24 amino acids of the N-terminus of authentic bGH has been ligated to the digested pRO12. The resulting plasmid, designated pSAL 5200-6, has the restriction map shown in FIG. 3. The plasmids of this invention may also be engineered to produce human superoxide dismutase (SOD) analogs thereof or mixtures of SOD analogs. A fragment of pJH200 (ATCC Accession No. 39783) containing the .lambda.P.sub.L promoter and C.sub.II ribosomal binding site was isolated and then inserted into a plasmid pSOD NH-10 which contains the gene for human SOD to form a plasmid designated pSOD NH-550 as shown in FIG. 13. A fragment containing both the .lambda.P.sub.L promoter and the SOD gene was isolated from pSOD NH-550 following digestion with AluI. After the addition of BamHI linkers and subsequent restriction with BamHI, the fragment was inserted into the unique BamHI site of pBRM. pBRM is a high copy number plasmid which has been deposited under ATCC Accession No. 37283. The resulting plasmid is designated pSOD.alpha.2. It has the restriction map shown is FIG. 13. This plasmid has been deposited in E. coli strain A2097 under ATCC Accession No. 39786. Plasmid pSOD.alpha.2 (ATCC Accession No. 39786) contains the C.sub.II ribosomal binding site. This ribosomal binding site has been replaced with a fragment containing the .beta.-lactamase promoter and Shine-Dalgarno ribosomal binding site isolated from an EcoRI-AluI digest of pBLA1l. (Plasmid pBLA11 has the restriction map shown in FIG. 14 and has been deposited in Escherichia coli strain A1645 under ATCC Accession No. 39788.) The C.sub.II ribosomal binding site is removed from plasmid pSOD.alpha.2 as shown in FIG. 14. pSOD.alpha.2 is partially restricted with EcoRI, filled in with DNA polymerase I (Klenow) and religated, so that the only remaining EcoRI site in the plasmid is located at the 5' end of the C.sub.II RBS. The resulting plasmid, designated pSOD.alpha.13 was digested with NdeI, filled in with DNA polymerase I (Klenow) and then digested with EcoRI. The large fragment was isolated and ligated to the fragment containing the .beta.-lactamase promoter and ribosomol binding site isolated from pBLA11 to form plasmid pSOD.beta.1. pSOD.beta.1 may be modified to include a tetracycline resistance gene fragment (Tet.sup.R) instead of an ampicillin resistence gene fragment (Amp.sup.R). The Amp.sup.R fragment was removed from pSOD 1 by digestion with PstI followed by partial BamHI. The resulting plasmid was filled in with DNA polymerase I (Klenow). The Tet.sup.R gene fragment was separately isolated from an EcoRI-AvaI digest of pBR322, filled in and ligated to the filled in plasmid. (Plasmid pBR322 is widely available, e.g. from the American Type Culture Collection as ATCC Accession No. 37017). The then resulting plasmid is designated pSOD.beta..sub.1 T.sub.11. It has the restriction map shown in FIG. 15 and has been deposited with the American Type Culture Collection and assigned Accession No. 53468. The plasmid pSOD.beta..sub.1 T.sub.11 produces a mixture of two hSOD analogs: (1) the non-acetylated analog of human SOD having an amino acid sequence identical to that of natural human CuZn superoxide dismutase (non-acetylated hCuZn SOD analog); and (2) the non-acetylated analog of human SOD having the amino acid sequence identical to that of natural human CuZnSOD and having the amino acid sequence ser-met attached to the amino terminus (non-acetylated ser-met hCuZnSOD analog). The composition of the mixture may range from about 90% to about 95% by weight of the non-acetylated hCuZnSOD analog and from about 5% to about 10% by weight of the non-acetylated ser-met hCuZnSOD analog. A preferred composition is one wherein the non-acetylated hCuZnSOD analog is greater than about 93% by weight of the mixture and the non-acetylated ser-met hCuZnSOD analog is less than about 7% by weight of the mixture. A more preferred composition is one wherein the non-acetylated hCuZnSOD analog is approximately 95% by weight of the mixture and the non-acetylated ser-met hCuZnSOD analog is approximately 5% by weight of the mixture. Other plasmids which may be used to produce human superoxide dismutase or analogs thereof are pSOD.beta.MAX.sub.12 and pSOD.beta.MAX.sub.10. The construction of these plasmids is shown in FIGS. 26-30. Each of these plasmids exclusively produces the non-acetylated hSOD analog having an amino acid sequence identical to that of natural human CuZnSOD. One further plasmid which may be used to produce human superoxide dismutase is designated pSOD.beta..sub.1 -BA2. Its construction from pSOD.alpha.13 is shown in FIG. 17. The vector of this invention, e.g. pR0211 may also be engineered to produce porcine or chicken growth hormones. Thus, as shown in FIG. 4, porcine growth hormone cDNA was isolated from an NdeI digest of ppGH-NdeI/RI. The resulting fragment containing the pGH gene was ligated to an NdeI digest of pRO211. The resulting plasmid, designated p3008, has been deposited in E. coli strain A2097 under ATCC Accession No. 39804. In another embodiment of the invention two chicken growth hormone fragments were isolated from NdeI-BamII digest of pcGH-NdeI/RI as shown in FIG. 5. The two cGH fragments were ligated to a phosphorylated synthetic linker which codes for the first 18 amino acids of the N-terminus of authentic cGH. The sequence of the linker was:
The resulting fragment was then ligated to a NdeI digest of pRO211 to form the plasmid designated p5002 which has the restriction map shown in FIG. 5. The vectors of this invention may also be engineered to produce human apolipoprotein E. The gene for human apoplipoprotein E (ApoE) may be isolated from plasmid pApoE-EX2 by NdeI digestion. pApoE-Ex2 has the restriction map shown in FIG. 18. It has been deposited in E. coli strain A1645 under ATCC Accession No. 39787. The ApoE gene (cDNA) may be placed in various plasmids. Among the preferred embodiments is plasmid pTV-188 which has the restriction map shown in FIG. 18. pTV-188 was constructed by ligation of the ApoE gene isolated from pApoE-Ex2 to a StuI digest of plasmid pSOD.beta..sub.1 T.sub.11. pTV-188 contains the Tet.sup.R fragment, the.lambda.P.sub.L promoter sequence, the .beta.-lactamase promoter and Shine-Dalgarno sequence. This plasmid expresses an ApoE fused protein. Another preferred embodiment of a plasmid which contains the ApoE gene is pSAL 160-5 which has the restriction map shown in FIG. 23. pSAL 160-5 was constructed from pTV 104(2) (ATCC No. 39384) and plasmid pTV-170, (see also FIG. 20). The ApoE gene was isolated from pTV-170 and inserted into pTV 104(2) at the PstI site within the human growth hormone gene sequence. The resulting plasmid pSAL 160-5 contains the Amp.sup.R fragment and the .lambda.P.sub.L promoter sequence. Using the same approach other plasmids may be prepared by replacing the gene encoding the desired polypeptide at the second restriction enzyme site of the plasmid. Various host vector systems involve E. coli A1637, A1645, A2606, A2097, A1563, A4200, A4255 and A4048 and the plasmid described herein may be used to produce different polypeptides such as bovine, porcine, chicken and human growth hormones, human superoxide dismutase and human apoliprotein E. To do so, the host vector system is grown under suitable conditions permitting production of polypeptide which is then recovered. Suitable conditions involve growth of the host vector system for an appropriate period of time at about 42.degree. C. Desirably, the period of growth at 42.degree. C. is about 1 to 5 hours. Suitable media include casein hydrolysate. By means of the preceding method a number of bGH, pGH, cGH, ApoE and SOD analogs have been prepared. ApoE analogs have been prepared which have an amino acid sequence identical to that of natural ApoE except for variations at the N-terminus. Examples include the following: 1) amino acid methionine added to N-terminus of natural human apolipoprotein E; 2) natural human apolipoprotein E to the N-terminus of which is attached the 42 amino acid N-terminal sequence of human superoxide dismutase and then methionine; and 3) natural human apolipoprotein from which the 11 N-terminal amino acids have been deleted and replaced by the 45 amino acid N-terminal sequence of mature human growth hormone followed by methionine. A pGH analog has been prepared in which the amino acid methionine is added to the N-terminus of natural porcine growth hormone. A cGH analog has been prepared in which the amino acid methionine is added to the N-terminus of natural chicken growth hormone. SOD analogs have been prepared which have an amino acid sequence identical to that of natural SOD except for variations at the N-terminus. Examples include the following: 1) natural human SOD which is non-acetylated; 2) natural human SOD which is non-acetylated and non-glycosylated; 3) natural human SOD which is non-acetylated and has the ser-met amino acid sequence attached to the amino terminus; and 4) natural human SOD which is non-acetylated and non-glycosylated and has the ser-met amino acid sequence attached to the amino terminus. These SOD analogs or a mixture of same may be used to catalyze the dismutation or univalent reduction of the superoxide anion in-the presence of proton to form hydrogen peroxide as shown in the following equation: ##STR1## Veterinary compositions may be prepared which contain effective amounts of one or more bGH, cGH or pGH analogs and a suitable carrier. Such carriers are well known to those of ordinary skill in the art. The analogs may be administered directly or in the form of a composition to a cow in order to increase milk or meat production, to a chicken in order to increase meat production or to a pig in order to increase meat production. Pharmaceutical compositions may be prepared which contain effective amounts of one or more ApoE analogs and a suitable carrier. Such carriers are well known to those skilled in the art. The analogs may be administered directly or in the form of a composition to a human subject, e.g., to treat deficiencies in ApoE production by the subject, or to treat atherioscelerosis. Veterinary and pharmaceutical compositions may also be prepared which contain effective amounts of SOD or one or more SOD analogs and a suitable carrier. Such carriers are well-known to those skilled in the art. The SOD or analog may be administered directly or in the form of a composition to the animal or human subject, e.g., to treat a subject afflicted by inflammations or to reduce injury to the subject by oxygen-free radicals on reperfusion following global ischemia or organ transplantation e.g., kidney transplantation. The SOD or analog may also be added directly or in the form of a composition to the perfusion medium of an isolated organ, e.g., to reduce injury to an isolated organ by oxygen-free radicals on perfusion after excision, thus prolonging the survival period of the organ, e.g. cornea. Additionally, the SOD or analog may be used to reduce spinal injury and for bronchial pulmonary dysplasia. EXAMPLES The examples which follow are set forth to aid in understanding the invention but are not intended to, and should not be construed to, limit its scope in any way. The examples do not include detailed descriptions for conventional methods employed in the construction of plasmids, the insertion of genes encoding polypeptides of interest into such plasmids or the introduction of the resulting plasmids into bacterial hosts. Such methods are well known to those of ordinary skill in the art and are described in numerous publications including by way of example the following: T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning; A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1982). Methods in Enzymology, vol. 65, "Nucleic Acids (Part 1)," edited by Lawrence Grossman and Kivie Moldave, Academic Press New York (1980). Methods in Enzymology, vol. 68, "Recombinant DNA," edited by Ray Wu, Academic Press, New York (1981). Methods in Enzymology, vol. 100, "Recombinant DNA (Part B)," edited by Ray Wu, Lawrence Grossman and Kivie Moldave, Academic Press, New York (1983). Methods in Enzymology, vol. 101, "Recombinant DNA (Part C)," edited by Ray Wu, Lawrence Grossman and Kivie Moldave, Academic Press, New York (1983). Principles of Gene Manipulation, An Introduction to Genetic Engineering, 2nd Edition, edited by R. W. Old and S. B. Primrose, University of California Press (1981). H. V. Bernard, et al., Gene (1979) 5, 59. A. B. Oppenheim, et al., J. Mol. Biol. (1982) 158, 327. E. Remaut, et al., Gene (1981) 15, 81. Example 1 Expression Vectors As used herein the term "expression vector" refers to a group of plasmids useful for expressing desired genes in bacteria, particularly in E. coli. The desired gene may be inserted into the expression vector or alternatively, the promoters on the expression vector may be excised and placed in front of the desired gene. pJH200 pJH200, shown in FIG. 2, is composed of a DNA inserted into the multicopy plasmid pBR322. The salient features of the .lambda.DNA are that it contains the .lambda.P.sub.L promoter, the leftward N utilization site (nut.sub.L), an EcoRI restriction site, the t.sub.RI termination site, followed by the C.sub.II ribosomal binding site and an ATG initiation codon which is part of the NdeI restriction site. One hundred and sixteen (116) base pairs downstream of the NdeI restriction site are four unique restriction sites as shown in FIG. 2. The restriction sites enable facile insertion of the desired gene. The C.sub.II ribosomal binding site differs from the natural ribosomal binding site by a single point mutation. pJH200 was constructed from pOG11 (A. Oppenheim, et al., J. Mol. Biol. (1982) 158; 327) and contains the .lambda.P.sub.L promoter and the C.sub.II ribosomal binding site found in pOG11. However, 346 bp of .lambda.DNA located between the .lambda.P.sub.L promoter and the C.sub.II ribosomal binding site have been deleted, and an EcoRI restriction site has been introduced at the junction between these two elements. Also, a multi-restriction site linker was introduced "downstream" of the ribosome binding site. pJH200 has been deposited with the American Type Culture Collection under ATCC No. 39783. pRO211 pRO211, shown in FIG. 2 and described in detail in the Description of Figures, was derived from pJH200 by eliminating one of the two NdeI restriction sites. pJH200, pRO211 and derivatives thereof containing eucaryotic genes may be maintained in suitable E. coli hosts. The most important feature of a suitable host is that it provide the thermosensitive repressor cI857 and the anti-termination N protein. (M. E. Gottesman, et al., J. Mol. Biol. (1980) 140; 57-75). pRO211 has numerous advantages over previously described expression vectors including: 1. extremely high levels of expression The vector is capable of directing expression of foreign proteins in E. coli at levels as high as 35% of the total cellular protein. 2. replaceable ribosomal binding site pRO211 contains a unique EcoRI site which is located "upstream" of the ribosomal binding site, and an NdeI site located "downstream" of the ribosomal binding site. Thus, the ribosomal binding site is bounded by two unique restriction sites. This enables facile excision of the present ribosomal binding site (the .lambda.C.sub.II ribosomal binding site) and substitution of virtually any other natural or synthetic ribosomal binding site without altering other features of the plasmid. This greatly facilitates optimal expression of desired polypeptides. 3. thermoinducible regulation of expression The .lambda.P.sub.L promoter is inactive when the C.sub.I repressor is bound to it. The cI857 repressor is thermosensitive, that is, it binds to the promoter at 30.degree. C. but is inactivated at 42.degree. C. Thus, by increasing the temperature of fermentation to 42.degree. C. the host bacteria are induced to produce the desired protein. The advantages of such a system include the following: (a) A foreign protein which is toxic to Escherichia coli can be produced late in the fermentation process thus avoiding early cell death, (b) Overproduction of a protein may stabilize the protein and prevent proteolytic degradation. (Cheng, Y. E., et al., Gene (1981) 14, 121). Thus, "instantaneous" overproduction using a tightly regulated promoter such as .lambda.P.sub.L may be preferable to continuous low level production. 4. simplified induction protocol Protein production by the plasmids described in this patent application and in copending, coassigned U.S. patent application Ser. No. 514,188 is regulated by the thermosensitive cI857 repressor. The induction protocol required by the plasmids described in the copending, coassigned application involved induction at 42.degree. C. followed by growth at 38.degree. C. In contrast, the optimal induction of protein synthesis when using the vectors pJH200, pRO211 or their plasmid derivatives involved induction at 42.degree. C. followed by growth at the same temperature, i.e. 42.degree. C. This eliminates the need to cool the fermentor. 5. copy number The .lambda.P.sub.L promoter in pJH200 and pRO211 is found on a plasmid with a copy number higher than the .lambda. transducing phage vectors which are present in E. coli. This increases expression levels. 6. ribosome binding site and initiation codon This expression vector contains a strong procaryotic ribosomal binding site (RBS) as well as a translation initiation codon (ATG). Thus, any eucaryotic gene may be cloned without adding the initiation codon. Furthermore, the efficient RBS increases levels of expression. The ribosome binding site is the .lambda.C.sub.II ribosomal binding site. The sequence of the ribosomal binding site is: TAAGGAAGTACTTACAT ATTCCTTCATGAATGTA One base pair is different from the ribosomal binding site found in the wild type A. 7. convenient restriction site The expression vector has a unique NdeI restriction site which contains within the site the ATG initiation codon. This permits proper positioning of the desired gene. The unique NdeI site is found immediately after the ribosomal binding site. 8. convenient restriction sites for gene insertion Located 116 base pairs downstream of the NdeI restriction site are 4 other unique restriction sites in the following order: BglII, SmaI, HindIII and ClaI. The multiplicity of unique restriction sites enables facile insertion of desired genes. 9. nut site N protein, which is provided by the host, binds the Nut site on the expression vector and thereby prevent termination of transcription at the t.sub.RI site or premature transcription termination within the cloned gene. 10. Strains Suitable hosts for the described vectors and plasmids are strains of E. coli suitable for transformation, including A1637, A2602, A1563, A1645 (C600 r.sup.- m.sup.+ gal.sup.+ thr.sup.- leu.sup.- lac.sup.- bl (.lambda.cI857.DELTA.Hl .DELTA.BamHI N.sup.+)) and A2097 (A1645 lac .DELTA.XA21 proC::Tn 10). Example 2 Animal Growth Hormones I. pRO12 The construction of pRO12 is shown in FIG. 2 and described in the Description of the Figures. bGH cDNA from pAL500 whose construction is shown in FIG. 1, was manipulated prior to insertion into pRO211 to provide the correct reading frame and an NdeI restriction site. pRO12 was introduced into Escherichia coli strain A1645 by transformation using methods known to those of ordinary skill in the art. This strain produces upon growth and induction an analog of bovine growth hormone (bGH) having the amino acid sequence met-asp-gin added to the N-terminus of the phenylalanine form of natural bGH. The amount of bGH analog produced by pRO12 was about 30-36% of the total protein produced by the bacteria as calculated by scanning Coomasie blue-stained SDS polyacrylamide gels (Table I). II. pSAL 5200-6 The construction of pSAL 5200-6 is shown in FIG. 3 and described in the Description of the Figures. The DNA sequence coding for met-phe bGH was obtained by restricting pRO12 with PvuII and NdeI and inserting a synthetic DNA fragment formed from two single-stranded synthetic oligonucleotides having 10 base pair overlapping segments. pSAL 5200-6 was introduced into Escherichia coli strain A1645 by transformation using known methods. This strain produces upon growth and induction an analog of bGH having a methionine added to the amino terminus of phe bGH. The amount of the met-phe bGH analog produced by pSAL 5200-6 was about 18-20% of the total protein produced by the bacteria as calculated from scanning Coomasie-stained SDS polyacrylamide gels. The methods used to grow the strain, recover the bGH produced and purify the bGH are the same as those described hereinafter in Example 5 for bGH production from pRO12. III. p3008 The construction of p3008 is shown in FIG. 4 and described in the Description of the Figures. p3008 has been deposited with the American Type Culture Collection under ATCC No. 39804. The DNA sequence coding for met-phe pGR (porcine growth hormone) was obtained by inserting pGH cDNA into pRO211. p3008 was introduced into Escherichia coli strain A1645 by transformation using methods known to those of ordinary skill in the art. This strain produces upon growth and induction pGH having a methionine added to the amino terminus of phe pGH. The amount of the met-phe pGH analog produced by p3008 was about 18-20% of the total protein produced by the bacteria as calculated from scanning Coomasie-stained SDS polyacrylamide gels. The methods used to grow the strain, recover the pGH produced and purify the pGH are the same as those described hereinafter in Example 5 for bGH production from pRO12. IV. p5002 The construction of p5002 is shown in FIG. 5 and described in the Description of the Figures. The DNA sequence coding for met-phe cGH (chicken growth hormone) was obtained by inserting cGH cDNA into pRO211 and completing the 5' end of the gene with synthetic oligonucleotides linkers. p5002 was introduced into Escherichia coli strain A1645 by transformation using known methods. This strain produces upon growth and induction cGH having a methionine added to the amino terminus of phe cGH. The amount of the met-phe cGH analog produced by p5002 was about 18-20% of the total 5 protein produced by the bacteria as calculated from scanning the Coomasie-stained SDS polyacrylamide gels. The methods used to grow the strain, recover cGH produced and purify the cGH are the same as those described hereinafter in Example 5 for bGH production from pRO12.
ABBREVIATIONS CHCN=Constitutive high copy number Amp.sup.R =Ampicillin resistance Tet.sup.R =Tetracycline resistance T.sub.1 T.sub.2 =Transcription termination sequences cI.sup.434 =Plasmid stabilization cI.sup.434 system Example 3 Human Cu-Zn Superoxide Dismutase (SOD) The starting point for Cu-Zn SOD cDNA modifications is the plasmid pS61-10 described in Lieman-Hurwitz, J., et al., PNAS (1982), 79:2808. The SOD cDNA is also described in copending U.S. patent application Ser. No. 489,786, filed Apr. 29, 1983. The SOD cDNA was modified to introduce an NdeI restriction site at the 5' end of the gene and a HindIII restriction site at the 3' end of the gene. The resulting plasmid, pSODNH-10, contains SOD cDNA bounded by unique restriction sites. Modification of hSOD cDNA at 5'-End and Construction of pSODNH-10 The modification of hSOD cDNA at the 5'-end and construction of pSODNH-10 is shown in FIG. 31 and described in the Description of the Figures. Plasmid pS61-10 was digested with PstI and the small PstI-PstI 620 bp fragment containing hSOD DNA was isolated by electrophoresis on 1% agarose gel. The purified fragment was dissolved in 50 ul of TE buffer and separated into two equal aliquots. The first aliquot was treated with DNA polymerase (Klenow fragment) in the presence of all 4 dNTP's in order to obtain a blunt-ended fragment. The Klenow reaction was carried out at 16.degree. C. for 30 minutes and the reaction was terminated by phenol-chloroform extraction and ethanol precipitation. The DNA fragment was dissolved in ligation buffer and was ligated to HindIII phosphorylated linkers with the sequence: CAAGCTTG GTTCGAAC The reaction was terminated by heating at 70.degree. C. for 5 minutes, and treated with HindIII (100 units). The fragment was then ligated to pBR322 DNA which was digested with HindIII (100 units). The fragment was then ligated to pBR322 DNA which was digested with HindIII and treated with bacterial alkaline phosphatase. The DNA ligation mixture was used to transform E. coli strain 1061 and Amp.sup.R clones were selected. These clones were screened by in situ filter hybridization to a nicked translated radioactive probe containing the hSOD DNA sequences. One of the positive clones, pSODH3, was analyzed by restriction mapping. The second aliquot of the 620 bp PstI-PstI fragment was digested with FokI and the 229 bp FokI-FokI fragment was purified by electrophoresis on a 1% agarose gel redissolved in ligation buffer and ligated to a synthetic phosphorylated DNA linker with the sequence:
The reaction was stopped by heating at 70.degree. C. for 5 minutes and then the DNA was digested with NdeI and StuI. The newly formed 127 bp fragment with the synthetic linkers was ligated with T4 DNA ligase to the large DNA fragment of plasmid pSODH3 which was obtained by digestion with NdeI, StuI and SalI: NdeI-StuI fragment of about 2560 bp was isolated. The DNA ligation mixture was used to transform E. coli strain 1061 and Amp.sup.R transformants were selected. The clones were screened for the right plasmid construction by NdeI and HindIII double digestion. One of these clones (pSOD NH-10) was sequenced and has been used for the expression of the human CuZn hSOD. I. pSOD.alpha.2 The construction of pSOD.alpha.2 is shown in FIG. 13 and described in the Description of the Figures. pSOD.alpha.2 has been deposited with the American Type Culture Collection under ATCC No. 39786. To construct pSOD.alpha.2, the .lambda.P.sub.L promoter, the Nut.sub.L and the C.sub.II ribosomal binding site were excised from the expression vector pJH200 and placed in front of the SOD gene of plasmid pSOD NH-10. Then, the fragment containing both the promoter, the RBS and the SOD gene was inserted into the vector pBRM (Hartman, J. R.,et al., PNAS 79:233-237 (1982). pBRM has been deposited with the American Type Culture Collection under ATCC No. 37283. pSOD.alpha.2 was introduced into Escherichia coli strain A2097 by transformation using known methods. The clones obtained produce upon growth and induction an SOD analog protein. The amount of SOD analog produced by pSOD.alpha.2 was about 0.1-0.3% of the total protein produced by the bacteria as calculated from scanning of Coomasie-stained SDS polyacrylamide gels (Table II). The SOD analog produced is probably identical to that produced by pSOD.beta.1 described in the following paragraph. II. pSOD.beta.1 The construction of pSOD8l is shown in FIG. 14 and described in the Description of the Figures. To construct pSOD.beta.1, the C.sub.II RBS of pSOD.alpha.2 was replaced with the -lactamase promoter and RBS derived from pBLA1l. pBLA11 has been deposited with the American Type Culture Collection under ATCC No. 39788. pBLA11 contains the promoter and ribosomal binding site of the .beta.-lactamase gene found in pBR322 between coordinates 4157 and 4353. An EcoRI linker was added upstream of the promoter and a multi-restriction site linker was added immediately after the initiation codon ATG. Thus, the sequence of the coding strand beginning with the initiation codon is ATGAGCTCTAGAATTC. pSOD.beta.1 was introduced into Escherichia coli strain A1645 by transformation using known methods. The clones obtained produce upon growth and induction an SOD analog. The human Cu-Zn SOD analog produced differs from natural human Cu-Zn SOD in that the amino terminus alanine is not acetylated, as demonstrated by amino acid sequencing stoichiometry while the natural human SOD is acetylated at the amino terminus alanine (Hartz, J. W. and Deutsch, H. F., J. Biol. Chem. (1972) 234:7043-7050; Jabusch, J. R., et al., Biochemistry (1980) 19:2310-2316; Barra, et al., FEBS Letters (1980) 120:53 and Oberley, L. W., Superoxide Dismutase, Vol. I, (1982), CRC Press, Florida, pp. 32-33.). Furthermore, the natural human SOD is glycosylated (Huber, W., U.S. Pat. No. 3,579,495, issued May 18, 1971) while bacterial-produced human SOD is almost certainly not glycosylated, because Escherichia coli does not glycosylate proteins which it produces. The amino acid sequence of the bacterial-produced SOD analog is identical to that of mature human SOD and does not contain a methionine residue at its N-terminus. The amount of SOD produced by pSOD.beta.1 was about 3-8% of the total protein produced by the bacteria as calculated from scanning of Coomasie-stained SDS polyacrylamide gels (Table II). The methods used to grow the strain, recover the SOD produced and purify the SOD are the same as those described hereinafter in Example 7 for pSOD.beta..sub.1 T.sub.11. III. pSOD.sub..beta.1 T.sub.11 The construction of pSOD.sub..beta.1 T.sub.11 is shown in FIG. 15 and described in the Description of the Figures. The gene coding for ampicillin resistance of pSOD.alpha.1 was replaced with the gene coding for tetracycline resistance derived from pBR322. pSOD.beta..sub.1 T.sub.11 has been deposited with the American Type Culture Collection and assigned ATCC Accession No. 67177. The amount of SOD analog produced by pSOD.beta..sub.1 T.sub.11 was about 8-13% of the total protein produced by the bacteria as calculated from scanning of Coomasie-stained SDS polyacrylamide gels (Table II). The SOD produced by pSOD.beta..sub.1 T.sub.11 is a mixture of SOD analogs. More than about 93% by weight of the SOD produced by pSOD.beta..sub.1 T.sub.11 is the non-acetylated form of natural human superoxide dismutase having an amino acid identical to that of natural human CuZn superoxide dismutase and less than 70% by weight is the non-acetylated form of natural human superoxide dismutase having an amino acid sequence identical to that of natural human CuZn superoxide dismutase and having the amino acid sequence ser-met at the amino terminus. As used throughout this specification, the term SOD analog produced by pSOD.beta..sub.1 T.sub.11 means a mixture of these SOD analogs. IV. pSOD.beta..sub.1 -BA2 The construction of pSOD31-BA2 is shown in FIG. 17 and described in the Description of the Figures. The C.sub.11 ribosomal binding site of pSOD.alpha.13 was replaced by a synthetic DNA fragment with the sequence:
which is similar to the sequence of the natural .beta.-lactamase RBS. pSOD.beta.1-BA2 was introduced into Escherichia coli strain A1645 by transformation using methods known to those of ordinary skill in the art. The clones obtained produce upon growth and induction an analog of human SOD. The amount of SOD produced by pSOD6l-BA2 was about 2-4% of the total protein produced by the bacteria as calculated from scanning of Coomasie-stained SDS polyacrylamide gel (Table II). The SOD analog produced is identical to that produced by pSOD.beta.1.
ABBREVIATIONS Amp.sup.R =Ampicillin resistance Tet.sup.R =Tetracycline resistance T.sub.1 T.sub.2 =Transcription termination sequences Example 4 Human Apolipoprotein E (ApoE3) The starting point for ApoE3 cDNA modifications was the plasmid pNB178 provided by Dr. John Taylor of the Gladstone Foundation, San Francisco, Calif. This plasmid contains a full length cDNA copy of the human ApoE3 gene. The cDNA in pNB178 was modified to remove noncoding DNA at the 5' end of the gene and to add NdeI restriction sites at both ends of the gene. This ApoE3 cDNA fragment was inserted into the vector pND5 (described in copending, coassigned U.S. patent application Ser. No. 514,188, filed Jul. 15, 1983). The resulting plasm |